crispr cas9 spacer plasmids  (Addgene inc)

Journal: mSphere

Article Title: CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii

doi: 10.1128/mSphere.00474-21

Figure Lengend Snippet: Generating a stable S. pyogenes dCas9-expressing parasite strain. (A) Expression construct and strategy for generating a clonal Spy .dCas9-expressing strain. Spy .dCas9 was expressed with an N-terminal FLAG tag. The coexpressed “decoy” sgRNA targets downstream of the endogenous NHE1 ORF and was previously shown to mitigate toxicity caused by the heterologous expression of Spy .Cas9 ( , ). Subsequent to the design of this construct, it was shown that the decoy sgRNA does not improve Spy .dCas9 expression . Following transfection and chloramphenicol selection of this construct in wt parasites, the resulting population was subcloned by limiting dilution to isolate CRISPRi strain 1 (i1). CAT, chloramphenicol acetyltransferase. (B) Immunoblots probing for FLAG and parasite actin. The expected molecular weight of FLAG-tagged Spy .dCas9 is 165 kDa. Actin served as a loading control. (C) Representative immunofluorescence images of formaldehyde-fixed intracellular parasites. Cells were stained for FLAG. Parasite actin provided a cytosolic parasite stain, and Hoechst was used to stain host and parasite DNA. Bar, 5 μm.

Article Snippet: The plasmids for generating Toxoplasma stably expressing Spy. dCas9 and Sth. dCas9, as well as the universal recipient plasmids for Cas9 spacers with specific S. pyogenes and S. thermophilus sgRNA scaffolds, are available from Addgene.

Techniques: Expressing, Construct, FLAG-tag, Transfection, Selection, Western Blot, Molecular Weight, Control, Immunofluorescence, Staining

Journal: mSphere

Article Title: CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii

doi: 10.1128/mSphere.00474-21

Figure Lengend Snippet: Targeted transcriptional repression using S. thermophilus dCas9. (A) Expression construct and strategy for generating a clonal Sth .dCas9-expressing strain. Sth .dCas9 was expressed with an N-terminal FLAG tag and transcriptionally linked with resistance and fluorescence markers via viral 2A peptides. Following transfection and chloramphenicol selection of this construct in wt parasites, the resulting population was subcloned by limiting dilution to isolate CRISPRi strain 3 (i3). BFP, blue fluorescent protein; NLS, nuclear localization signal. (B) Immunoblots probing for FLAG and parasite actin. The expected molecular weight of FLAG-tagged Sth .dCas9 is 138 kDa. Actin served as a loading control. (C) Representative immunofluorescence images of formaldehyde-fixed intracellular parasites. Cells were stained for FLAG. Parasite aldolase (ALD) provides a cytosolic parasite stain, and Hoechst was used to stain host and parasite DNA. Bar, 5 μm. (D) Engineered sgRNA sequences for Cas9 orthologs from S. pyogenes and from the S. thermophilus CRISPR1 locus which were used in this study. Matching nucleotide positions between the sgRNA scaffolds are indicated. (E) To-scale diagram comparing target sites and strandedness of sgRNAs from the two Cas9 orthologs at the SAG1 and mNG loci. PAMs used for the design of these sgRNAs are indicated. (F) Expression construct and strategy for generating sgRNA-expressing parasite populations in the Sth .dCas9 background. (G) Immunoblots probing for SAG1 and parasite actin in lysates from i3 and drug-selected i3-sgRNA transfectants. Actin served as a loading control. (H) Densitometric quantification of immunoblots probing for SAG1 abundance in lysates from i3, and drug-selected i3-sgRNA transfectants. SAG1 abundance was normalized to that of the loading control CDPK1. Data are means for 2 biological replicates. Corresponding blots are shown in Fig. S2 . Significance was calculated via an unpaired Student's t test. *, P ≤ 0.05; n.s., nonsignificant ( P > 0.05).

Article Snippet: The plasmids for generating Toxoplasma stably expressing Spy. dCas9 and Sth. dCas9, as well as the universal recipient plasmids for Cas9 spacers with specific S. pyogenes and S. thermophilus sgRNA scaffolds, are available from Addgene.

Techniques: Expressing, Construct, FLAG-tag, Fluorescence, Transfection, Selection, Western Blot, Molecular Weight, Control, Immunofluorescence, Staining

Journal: Microorganisms

Article Title: A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae

doi: 10.3390/microorganisms8030378

Figure Lengend Snippet: Morphology comparison between colonies of K. pneumoniae on parental strain Kp36 (mucoid, moist, and sticky) and phage 117-resistant mutant Kp36-117R (dry, rough, and transparent) on 1.5% LB agar.

Article Snippet: In order to delete the complete open reading frame of wcaJ from the chromosome of K. pneumoniae Kp36, CRISPR-Cas9 spacer plasmid was constructed by cloning wcaJ sequence (AGACAAATACGATATGGTAT) into pSGKP-spe (Addgene no. 117234), as previously described [ ].

Techniques: Comparison, Mutagenesis

Journal: Microorganisms

Article Title: A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae

doi: 10.3390/microorganisms8030378

Figure Lengend Snippet: Phage-resistant mutant Kp36-117R displays different phage adsorption rates when compared with wild-type strain Kp36. Phage 117 was added to the mid-log phase cultures of strains Kp36 and Kp36-117R at an MOI of 0.001. Unabsorbed phage particles were harvested by centrifuge and counted by double-layer plaque assays. These experiments were performed in triplicate with error bars showing the variation between each experiment.

Article Snippet: In order to delete the complete open reading frame of wcaJ from the chromosome of K. pneumoniae Kp36, CRISPR-Cas9 spacer plasmid was constructed by cloning wcaJ sequence (AGACAAATACGATATGGTAT) into pSGKP-spe (Addgene no. 117234), as previously described [ ].

Techniques: Mutagenesis, Adsorption

Journal: Microorganisms

Article Title: A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae

doi: 10.3390/microorganisms8030378

Figure Lengend Snippet: ( A ) Agarose gel electrophoresis of PCR products to verify the insertion of mobile genetic elements ( insA and insB ) in the phage resistant mutant Kp36-117R. Both PCR products, including wild-type strain Kp36, were confirmed by sequencing. ( B ) Schematic representation of wcaJ in K. pneumoniae Kp36 and Kp36-117R. Genes are represented as arrows.

Article Snippet: In order to delete the complete open reading frame of wcaJ from the chromosome of K. pneumoniae Kp36, CRISPR-Cas9 spacer plasmid was constructed by cloning wcaJ sequence (AGACAAATACGATATGGTAT) into pSGKP-spe (Addgene no. 117234), as previously described [ ].

Techniques: Agarose Gel Electrophoresis, Mutagenesis, Sequencing

Journal: Microorganisms

Article Title: A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae

doi: 10.3390/microorganisms8030378

Figure Lengend Snippet: Spot test assay of phage 117 and phage 31 on the parental K. pneumoniae strain Kp36 and its derived mutants (Kp36-117R, Kp36 Δ wcaJ , Kp36 pBAD, and Kp36-117R pwcaJ).

Article Snippet: In order to delete the complete open reading frame of wcaJ from the chromosome of K. pneumoniae Kp36, CRISPR-Cas9 spacer plasmid was constructed by cloning wcaJ sequence (AGACAAATACGATATGGTAT) into pSGKP-spe (Addgene no. 117234), as previously described [ ].

Techniques: Spot Test, Derivative Assay

Journal: Microorganisms

Article Title: A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae

doi: 10.3390/microorganisms8030378

Figure Lengend Snippet: The sensitivities of each strain to phage 117 and phage 31 were shown by calculating the efficiency of plating (EOP) on K. pneumoniae strain Kp36 and its derived mutants (Kp36-117R, Kp36 Δ wcaJ , Kp36-117R pBAD, and Kp36-117R pwcaJ) and their plaque morphologies. WT, wild-type.

Article Snippet: In order to delete the complete open reading frame of wcaJ from the chromosome of K. pneumoniae Kp36, CRISPR-Cas9 spacer plasmid was constructed by cloning wcaJ sequence (AGACAAATACGATATGGTAT) into pSGKP-spe (Addgene no. 117234), as previously described [ ].

Techniques: Derivative Assay, Mutagenesis, Plasmid Preparation

Journal: Microorganisms

Article Title: A Frameshift Mutation in wcaJ Associated with Phage Resistance in Klebsiella pneumoniae

doi: 10.3390/microorganisms8030378

Figure Lengend Snippet: Growth curves of the wild-type and mutant of K. pneumoniae strains. No significant differences were observed among the parental K. pneumoniae strain Kp36 and its derivative mutants (Kp36-117R, Kp36 Δ wcaJ , and Kp36-117R pwcaJ) after 2 h. Optical densities (OD 600 ) were measured at 1 h intervals over an 8 h period of incubation at 37 °C in LB broth with aeration. For strain Kp36-117R pwcaJ, media was supplemented with apramycin (100 μg/mL) and 0.4% L-arabinose. Error bars represent standard errors from the experiment performed in triplicate.

Article Snippet: In order to delete the complete open reading frame of wcaJ from the chromosome of K. pneumoniae Kp36, CRISPR-Cas9 spacer plasmid was constructed by cloning wcaJ sequence (AGACAAATACGATATGGTAT) into pSGKP-spe (Addgene no. 117234), as previously described [ ].

Techniques: Mutagenesis, Incubation